ASP Final – 76 Questions from Exams
all correctly answered
DNA codes for proteins that have specific functions, the proteins of interest in drug
therapy include what? Correct Answer: Receptors, transporters, metabolizing
enzymes
The DNA sequencing method with the synonyms “Sanger method” and “chain
terminating method” is based on what? Correct Answer: Incorporation of a
dideoxynucleotide in the chain
Gel electrophoresis relative to strands of DNA can do what? Correct Answer:
Separate DNA strands by as little as one nucleoside base
In amplification of DNA, what is required to initiate the formation of
complementary (or daughter) DNA strands from the template strand? Correct
Answer: Primers
Why do DNA “chain terminators” stop the expansion of a DNA strand? Correct
Answer: They lack the 3′ hydroxyl group
Strand 1: GCCGTCGTAACGGG
Strand 2: ACGGGCTCTGTCAGGTCGTCCA
Strand 3: GTCCAGTCGATGGCCTT
If the last base in each strand were the terminal base with a fluorescent dye
attached, what would the DNA sequence be, once the strands passed through a gel
electrophoresis system? Correct Answer: GTA
The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to
3.7]. What is the association/correlation between coffee and cancer? Correct
Answer: There is no association between coffee and stomach cancer based on this
data
What is the best measure to compare the outcomes among various different studies
to create a level playing field for looking at the results? Correct Answer: Number
needed to treat
ASP FINAL 76+ QUESTIONS &
ANSWERS A+ GRADED
Parametric statistics require 2 assumptions to be utilized appropriately by a
researcher. One assumption is that the data must be interval level data. What is the
other assumption? Correct Answer: Normally distributed or sample size greater
than or equal to 30
The gold standard of OBSERVATIONAL study designs that measures TRUE rate
(relative risk) rather than estimating the rate is? Correct Answer: Cohort
What is the odds ration an estimate of? Correct Answer: Relative risk
What is a study that reflects more of the real world setting and includes patients
with more than one disease state? Correct Answer: Effectiveness study
When will you not float at the surface of a fresh water lake? Correct Answer:
When your average body density is less than the density of fresh water
A neuron star has a mass of 2.50 x 10^28 kg and a density of 3.93 x 10^18 kg/m^3.
What is its volume? Correct Answer: 6.36 x 10^9 m^3
You are lying down on a bed of 3000 nails (I’m not sure why). Your body weight of
695 N is evenly distributed among the nails. Each nail has a tip diameter of 1.00
nm. What is the pressure at each nail point? Correct Answer: 2.95 x 10^5 Pa
For a hydraulic lift in a car garage designed to lift up a car using a relatively small
input force, what must be true about the force and pressure on the input versus the
output piston? Correct Answer: The force on the input piston is less than the force
on the output piston.
The pressure on the input piston is equal to the pressure on the output piston.
What is Archimedes’ principle? Correct Answer: An object submerged (partially or
wholly) in a fluid experiences an upward buoyant force. The buoyant force is equal
in magnitude to the weight of the fluid displaced by the object.
An athlete is weighted in the air and then in water. Assume that the athlete is
completely submerged in the fluid while weighing is done. the scale reading in air
was 750 N. The athlete’s average body density was determined to be 1.04 x 10^3
kg/m^3. What’s the volume of the athlete’s body and the athlete’s apparent weight
in water (the scale’s reading in water)? Correct Answer: 0.0736 m^3
29.0 N
ASP Exam| 685 Questions
with 100% Correct Answers
Presbycusis Correct Answer: Hearing loss due to old age
Presbyopia Correct Answer: impaired vision as a result of aging, difficulty
focusing
Byssinosis Correct Answer: Disease from inhaling cotton fibers. Also called
“brown lung disease” or “Monday fever”. Reaction against cotton, linen, hemp
products in textile/fabric industry.
Four (4) types of human errors discussed in Human Factors Engineering. Correct
Answer: “Errors C.O.S.T. time and money”
- Commission: doing something wrong
- Omission: leaving something out
- Sequence: doing something in the wrong order
- Timing: doing something out of allotted time, too fast or too slow
Does the employers have to post OSHA citations? Correct Answer: Yes, for 3 days
or until corrected.
Audiogram Correct Answer: Written record of hearing threshold at specified
frequencies.
Audiometer Correct Answer: a device that can present tones of different
frequencies, from low in pitch to high in pitch, at different volumes from soft to
loud
What dB at 3000 hz during an audiogram means the person can’t hear the tone?
Correct Answer: 30 dB
Factors that affect absorption of noise Correct Answer: angle to noise source,
frequency of noise, density, condition/cleanliness, type of mounting, shape of
surface
ASP EXAM 685 + QUESTIONS &
ANSWERS 2023 A+ GRADED 10%
VERIFIED
To improve noise absorption through engineering controls, what properties do you
want? Correct Answer: Good porosity, thickness, air gaps
Emissivity Correct Answer: Ratio of radiation emitted by a surface to the radiation
emitted by a black body at the same temperature. A black body is 1.0 (highest),
down to 0 (bright, reflective surfaces).
Emissivity of bright metal surfaces Correct Answer: Low – less than 0.1 (bright
metal is a good reflector), meaning it is good for reducing radiant heat.
Emissivity of unpolished surfaces Correct Answer: Close to 1.0, which is high,
meaning not great for reducing radiant heat.
Carpal tunnel affects what nerve and what parts of the hand? Correct Answer:
Median nerve. Thumb, pointer and ring fingers, NOT the pinky. Inflammation and
pain in the wrist. Thenar wasting is sign of advanced disease.
Metal Fume Fever Correct Answer: Acute condition from brief high exposure to
metal fumes (e.g., zinc, magnesium, their oxides). Symptoms appear from 4 to 12
hours after exposure — fever, shaking chills (flu-like). Recovery is quick. Workers
can develop immunity, but a break and re-exposure normally makes it worse.
What do altitude changes affect (and not affect) regarding fans? Correct Answer:
Horsepower needed (air has less mass), static pressure (not as much needed). But
the CFM (volumetric rate) is NOT changed by altitude, and neither is RPM of the
fan.
SCBA & airline respirator rules Correct Answer: Must be Grade D or higher; can
use high pressure air; oil pumped with filtering is acceptable. Medical oxygen is
NOT allowed – dangerous because of increased flammability.
Abduction, adduction, flexion, extension Correct Answer: Adbuction: increasing
angle of arm to body, AWAY.
Adduction: decreasing angle of arm to body, TOWARD.
Extension: increasing angle of forearm to bicep.
Flexion: decreasing angle of forearm to bicep.
Grade D breathing air Correct Answer: 19.5%-23.5% oxygen
<5 mg/m3 of oil
<10 ppm CO
<1000 ppm CO2.
TLV, PEL, IDLH for carbon monoxide Correct Answer: TLV of 50 ppm (ACGIH);
STEL of 400.
IDLH of 1500 ppm (NIOSH)
PEL of 35-50 (OSHA); ceiling is 200, instantaneous is 1500.
Carbon Monoxide (CO) Correct Answer: Air pollution that is a product of
combustion of fossil fuels. Flammable, colorless, odorless, poisonous. Chemical
asphyxiate. Does NOT harm red blood cells, but reduces their oxygen-carrying
capacity.
Teratogen Correct Answer: an agent or factor that causes malformation of an
embryo or fetus. Does not propagate across generational lines.
Next best option to electric forklifts for emissions. Correct Answer: Convert the
forklift to LP gas.
Double insulation does not protect against shock in what circumstance? Correct
Answer: Water, wet locations
(Data terms) Random, stratified, systematic, cluster Correct Answer: Random:
everyone has an equal change. Stratified: separated by layers. Systematic:
patterned response. Cluster: confined to a location.
pH less than 7 Correct Answer: acid
pH greater than 7 Correct Answer: base
activated carbon Correct Answer: A form of specially treated, porous carbon, used
to absorb various odors and vapors. Has a non-polar surface.
Axial flow fans Correct Answer: High volume and low pressure drop; general &
dilution ventilation; NOT good for LEV; NOT used to move air through a duct;
sometimes used for comfort.
Centrifugal fans Correct Answer: Fan axis is perpendicular to flow — spits air out
90 degrees. Low noise. Suited to high pressures. Low to moderate static pressures;
used in heating & air conditioning; workhorse of industrial hygiene; sometimes
called squirrel cages; good for lint, wood chips & dust.
Forward blades in centrifugal fan Correct Answer: Blades are curved in the
direction of rotation. Used whenever a large air volume has to be moved in a tight
space. Requires more power, which can overload motors.
Backward blades in centrifugal fan Correct Answer: Blades are curved in the
opposite direction of rotation. More efficient than forward blades.
Paddle wheel or long-shaving wheel Correct Answer: Used with medium tip speed
for buffing exhaust, woodworking exhaust or when heavy dust must pass through
the fan.
Max travel distance of fire extinguisher in light hazard occupancies Correct
Answer: 75 ft. Includes places like churches, clubs, education centers, kennels,
museums, homes.
Inspection items for self-closing doors Correct Answer: 1) Lubrication on guides
& bearings
2) Binders are not bent, thus obstructing door
3) Chains/wire ropes have not stretched.
4) Fusible links are NOT painted.
Main cause of sprinkler system failure Correct Answer: 35% of the time: closed
water-supply valves.
Main cause of leaking sprinkler heads Correct Answer: Overheating from being
too close to heat-generating processes.
How often should sound level meters be calibrated? Correct Answer: Before &
after each survey
Particle sizes Correct Answer: Large: silica
Small: zinc
Safest method to determine electrical current Correct Answer: Split-core ammeter
Treating exposure to liquid oxygen Correct Answer: Warm water. Never rub or use
dry heat. Frozen tissue is painless but will be swollen & painful when thawed.
ASP Exam Preparation| 192 Questions
with 100% Correct Answers
Workers Comp – low fence Correct Answer: minimum dB loss before a worker is
eligible for compensation, because small hearing losses aren’t debilitating
Workers Comp – high fence Correct Answer: 100% hearing loss
Time-Loss Analysis Correct Answer: Technique that is based on the premise of a
natural course line for accidents –that is, with no outside intervention, each
accident sequence would eventually end.
Attractive Nuisance Doctrine Correct Answer: A person is under the duty to
prevent injury to children that may be attracted to something which could cause
harm
Business interruption recovery/business continuity Correct Answer: Allows
facility to continue serving its customers even though the facility was nearly
destroyed by a fire
Contributory negligence Correct Answer: When an injured person’s care for his
own safety was less than that reasonable for a prudent person under existing
conditions
Fright without physical contact Correct Answer: Neurological or emotional
disturbances that occurred without physical injury
Foreseeability applied to rescue Correct Answer: allows damages to rescuer if
someone could have foreseen that their actions were going to cause an incident
where aid would be needed
Obvious peril Correct Answer: A manufacturer is not required to warn prospective
users of products whose use involves an obvious peril, especially those that are
well known to the general public
Strict liability Correct Answer: Manufacturer of a product is liable for injuries due
to defects, no proof needed of negligence or fault
ASP EXAM 192 + QUESTIONS &
ANSWERS 2023 A+ GRADED 100%
VERIFIED
Dangerous Instrumentality Correct Answer: A person who keeps, maintains,
transports, or stores a dangerous creature, device or substance is liable for injury or
damage, regardless of fault, even when he exercises due care
Great care Correct Answer: High degree of care that a very prudent and cautious
person would undertake for the safety of others — (bus, trains, airplanes).
Res ipsa loguitur Correct Answer: occurrence of an accident is sufficient proof
that negligence existed
Sneak circuit analysis Correct Answer: A technique which is used to determine an
unintended energy route, which can allow an undesired function to occur, prevent
desired functions from occurring, or adversely affect the timing of functions
HAZOP Analysis Correct Answer: Multi-disciplinary team to brainstorm and
identify the consequences of deviations from design intent. Uses guide words
Failure modes effects analysis – FMEA Correct Answer: Classic inductive
reasoning process. Failure or malfunction of each component is considered and the
effects of the failure traced throughout the system
Fault tree analysis Correct Answer: Classic deductive reasoning process. Selects
the undesired outcome and all possible modes of happenings
Cut Set Correct Answer: Shortest path to failure in a fault tree
Velocity of discharge from a fire extinguisher Correct Answer: Q = 12.1 * square
root of P, Q = velocity of discharge, P = pressure in PSI
ASME and API Standard 620 Correct Answer: Code(s) utilized in the design and
construction of pressure vessels
Flow rate (in gpm) of water from fire hydrant Correct Answer: Q= k * square root
of P; “k factor” will be specific to the type of hydrandt
Pre-action sprinkler system Correct Answer: Water supply is activated by a a fire
alarm system. Protects against damage if to building if sprinkler pipes/heads leak