DNA Replication Practice Worksheet S Phase: Replication Fork On the following drawing, label the directions (5 and 3′) on both strands. Also labe strand, Okazaki fragments, replication fork, and DNA polymerase. : leading strand, lagging How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication? 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. -a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand is created for each of the two strands of the original double helix. d. Two new identical DNA molecules have been produced 7. (True or False) The process of DNA replication results in a copy of the original DNA molecule. 8. (True or False) DNA does not have to break apart to be copied. 9. (True or False) After DNA replication is complete, there are two new DNA molecules; one molecule has both of the original strands and one molecule has two new strands of DNA. 10. Where does DNA replication happen? 11. When does DNA replication happen? 12.Below are DNA strands. Make the complementary DNA strand: Original Strand: ATGCAAATTGCTCACCGGGGATCAGCACCGG Complementary Strand: Original Strand: AGGGGATCAGCACCGGATTTCATGAGCCCTA Complementary Strand:
The Correct Answer and Explanation is :
Let’s go through each question in detail, providing answers and explanations:
4. What does it mean that the two strands of DNA are complementary?
Answer: The two strands of DNA are complementary because each base on one strand pairs with a specific base on the other strand. Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). This pairing rule ensures the two strands are mirror images of each other, with the sequence of one strand determining the sequence of the other strand.
5. What is DNA replication?
Answer: DNA replication is the process by which a cell makes an identical copy of its DNA. This occurs before a cell divides (in preparation for mitosis or meiosis). The DNA molecule is unwound, and each strand serves as a template for synthesizing a new complementary strand, resulting in two identical DNA molecules.
6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order:
- b. The DNA double helix breaks or unzips down the middle between the base pairs.
- a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand.
- c. A complementary strand is created for each of the two strands of the original double helix.
- d. Two new identical DNA molecules have been produced.
Explanation: In the first step, the enzyme helicase unwinds the double helix and breaks the hydrogen bonds between complementary bases (step b). DNA polymerase then adds complementary nucleotides to each exposed strand (step a). As a result, two complementary strands are synthesized (step c). Finally, two identical DNA molecules are formed (step d).
7. (True or False) The process of DNA replication results in a copy of the original DNA molecule.
Answer: True. DNA replication creates two identical copies of the original DNA molecule, ensuring that genetic information is passed down accurately to daughter cells.
8. (True or False) DNA does not have to break apart to be copied.
Answer: False. DNA must “break apart” or “unzip” to expose the individual strands. This separation occurs when the hydrogen bonds between base pairs are broken, allowing the strands to act as templates for new complementary strands.
9. (True or False) After DNA replication is complete, there are two new DNA molecules; one molecule has both of the original strands and one molecule has two new strands of DNA.
Answer: False. After replication, two identical DNA molecules are produced. Each molecule contains one original (parental) strand and one newly synthesized strand. This is known as semi-conservative replication.
10. Where does DNA replication happen?
Answer: DNA replication happens in the nucleus of eukaryotic cells, while in prokaryotic cells, it occurs in the cytoplasm.
11. When does DNA replication happen?
Answer: DNA replication happens during the S phase (Synthesis phase) of the cell cycle, before a cell divides.
12. Below are DNA strands. Make the complementary DNA strand:
- Original Strand: ATGCAAATTGCTCACCGGGGATCAGCACCGG
- Complementary Strand: TACGTTTAACGAGTGGCCCCTAGTCGTGGCC
- Original Strand: AGGGGATCAGCACCGGATTTCATGAGCCCTA
- Complementary Strand: TCCCTTAGTCGTGGCCAATTCATCTCGGGT
Explanation:
Each base on the original strand of DNA pairs with its complementary base. Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). When writing the complementary strand, you follow the rule of base pairing. For example, “A” on the original strand pairs with “T” on the complementary strand, and “G” pairs with “C,” etc.
Replication Fork and DNA Structure
During DNA replication, the replication fork is the Y-shaped region where the DNA is split into two separate strands, creating the template for the new strands. DNA polymerase is the enzyme that adds new nucleotides to the growing DNA strand in the 5′ to 3′ direction. On the leading strand, synthesis is continuous, whereas on the lagging strand, the DNA is synthesized in short segments called Okazaki fragments due to the antiparallel nature of the strands.
This summary should help you understand the key concepts involved in DNA replication and its process!