ASP Associate Safety Professional Exam
A 40 ton gantry crane has been out of service for more than 6 months for
structural repair. It is required to be proof tested at ?? Before being used? – ANS 50 tons A body that has a definite volume but no definite shape is? – ANS A liquid A cage on a fixed ladder on a commercial ladder cannot extend any closer than how many feet from the ground? – ANS OSHA 1910.27 “cages shall extend down the ladder to a point of not less than 7 feet or more than 8 feet above the base of the ladder”. “A calorie is the amount of heat required to raise the temperature of one gram of water ____
BTU is the measure of energy and is the amount of heat required to raise
temperature of one pound of water_______” – ANS “1 degree Celsius
1 degree Farenheit
“
A commercial motor vehicle transporting hazardous materials is required
to display placards in which of the following locations? – ANS Front, rear
and both sides of vehicle
A fire resistive wall separating oxygen and fuel gases should be how high?
- ANS About five feet
A room designed for recharging of lead acid batteries does not require?? –
ANS Pressure relief panels
A solution contains 10-2 hydrogen ions per liter. What would this solution
be considered? – ANS A strong acid
Acclimatization to heat is generally achieved by requiring the employee to? - ANS Work for two hours per day for two weeks.
New workers and those returning from a prolonged absence should begin
with 20% of the workload on the first day, increasing incrementally by no
more than 20% each subsequent day.
During a rapid change leading to excessively hot weather or conditions
such as a heat wave, even experienced workers should begin on the first
day of work in excessive heat with 50% of the normal workload and time
spent in the hot environment, 60% on the second day, 80% on day three,
and 100% on the fourth day. Full acclimatization may take up to 14 days or longer depending on factors relating to the individual, such as
increased risk of heat illness due to certain medications or medical
conditions, or the environment.
According to 1910.145, what is the minimum reading distance when posting
a danger sign? – ANS Five feet
According to ANSI Z89.1-1997 specifications for helmets (hardhats) to
protect employees from impact of falling objects and from high voltage
electrical shock. Which of the following classes offer low voltage
protection? – ANS G
According to OSHA 1910.217 “Mechanical Power Press” requires how
much safe distance per second of stopping time from “point of operation
devices” to ensure the safety of the operator? – ANS 63 inches or 5.25
feet
According to OSHA HAZ Com; who has the responsibility to determine if a
material is hazardous? – ANS The manufacturer or importer of the
chemical
According to the Commercial Motor Vehicle Safety Act of 1986, a CDL is
required for what operation?? – ANS Single vehicle with a GVW of
26,000lbs.
According to the fire protection handbook, although increasing storage
heights increases fire intensity, storage heights up to _ feet in piled storage and up to __ feet in rack storage need not be adjusted. – ANS
“12 feet for piled
15 feet for rack storage
ASP CSP
Risk – ANS The measure of the probability and severity of a negative
event
Probability – ANS How likely the event is to occur. This includes
exposure, the more people exposed the more likely the event.
Risk Management Process – ANS 1 Evaluate (Risk ID)
2 Prioritize (Risk Analysis)
4 Cost Benefit (Financing)
4 Implement (Risk Elimination or Reduction)
5 (Administration of Risk Management Process)
Review
Objective evidence which is documentation
Healthy Worker Effect – ANS Workers tend to be healthier than the
population as a whole.
Risk Cost – ANS Probability x Cost
Residual Risk – ANS The Risk that remains after the preventative measure
have been taken
Threshold Risk Model – ANS ACGIH
There is some safe level to which everyone can be exposed without
increasing the probability of becoming sick.
No Threshold Risk Model – ANS There is no safe level. Every exposure
increase probability of becoming sick (ionizing rad)
ALAR
ALARA – ANS As Low As Reasonably Achievable
Purpose of Incident Investigation – ANS To prevent re-occurance, retro
active, to find facts – not to place blame.
Notes: Good apple bad apple by Dekker.
OSHA incident rate
Total incident case rate – ANS total injuries/illness x 200,000/Hrs worked
by all employees
ASP Exam Prep
Which type of machine guarding technique requires the least amount of
participation from employees? – ANS Physical Guard
According to Maslow’s Hierarchy of Needs, what must be met before one’s
safety needs can be met? – ANS Human Metabolic Requirements
Maslow’s hierarchy of needs – ANS physiological (human metabolic
requirements), safety, love/belonging, esteem, self-actualization
Most effective method for controlling exposures to airborne asbestos fibers
during the removal of asbestos insulation – ANS Wet the insulation
thoroughly prior to removal
respirator for asbestos removal – ANS negative pressure, air-purifying
respirators with HEPA filters
Teratogen – ANS a substance that crosses the placenta and harms the
fetus
How much heat would be released from the complete combustion of a 5 gal
container of gasoline. Density = 6.073 lbs/gas; heating value= 18,772
BTU/lb – ANS 570,012 BTU
In a Fault Tree analysis, the house shape indicates what? – ANS events
that are expected to occur under normal circumstances
Fault Tree Analysis – ANS a visual method for analyzing the
interrelationships among failures; top down, deductive failure analysis in
which an undesired state of a system is analyzed using Boolean logic to
combine a series of lower-level events
What is the most important duty of the safety manager at a facility? – ANS
Being a risk assessment resource to the management team
When using fire extinguishers, a common mnemonic device is “P-A-S-S”.
What does the “A” in PASS stand for? – ANS Aim. Pull Aim Squeeze
Sweep
Minimum Sample volume is equal to what? – ANS Limit of quantification
(LOQ) times 1,000 divided by the contaminant target concentration
An object of mass 92 kg rolls down a hill at 9.1 m/s. Calculate the
momentum of the object. p=mv – ANS 837.2 kg x m/s (p=mv ; m=mass (kg)
; v=velocity (m/s)
“White Finger” is an injury that can result from what? – ANS Vibration.
Disorder that affects the blood vessels, nerves, muscles, and joints of the
hand, wrist, and arm. White finger can cause poor blood circulation,
causing skin to become pale or waxy
What is the purpose of the Water Armor or “Turtle Suit” – ANS To protect
the body from high pressure blasts. Suit protects the chest, legs, and arms
from glancing blows of up to 40,000 psi
Which disease was once the leading cause of death in the United States? –
ANS Tuberculosis. Disease that attacks the lungs and other parts of the
body, spread through the air when infected people cough, sneeze, or spit
Paralysis, hallucinations, and hyper-salivation are all potential symptoms
of what disease? – ANS Rabies
What is the primary purpose of training? – ANS To solve a problem in the
workplace. Safety training program should be a well thought out and a
needs analysis should be performed
Computer based training is most helpful for what type of delivery method –
ANS Self-paced learning
Employees should be involved in audits when possible for what reasons –
ANS Workers are most in contact with potential safety/health hazards,
Employees are more likely to support and use programs in which they have
input, groups have a wider range of experience than individuals
You have three resistors valued respectively at 5Ω, 7Ω, and 10Ω in a
parallel circuit. What is the total resistance of the circuit?
1/Rparallel=1/R1 + 1/R2 + 1/Rn – ANS 2.27 (1/Rparallel = 0.2 + 0.14 + 0.1
1/Rparallel = 0.44
Rparallel=1/0.44-2.27)
ASP Prep
Rust, the most common kind of corrosion, is the action of which element
on iron or aluminum? – ANS Oxygen
Isopropyl alcohol has a flammability range between 2% and 12%; therefore,
the Upper Explosive Limit is: – ANS 12% alcohol in air
A worker’s exposure to an airborne contaminant in any 8-hour work shift of
any 40-hour work week is known as the: – ANS Time weighted average.
Calculating radioactive decay requires information on the initial quantity of
materials, quantity of material at the time of measurement, time interval
between the measurements, and the: – ANS Radioactive decay constant
for the materials.
The statistically determined time interval for a radioactive isotope to decay
by 50% is called the: – ANS Half life of the material.
Boyle’s law is expressed as: – ANS P1V1 = P2V2.
Often described as predictive, preventative, or proactive, which are tools
designed to measure the improvement of safety and health initiatives? –
ANS Behavior, condition, standard
Radiation strength or activity is often measured in: – ANS Curie.
Current equals voltage divided by the: – ANS Resistance
What happens to the sling tension of a rigged load when the sling angle
from the vertical is increased? – ANS The sling tension increases.
The proper angle to place a ladder to ensure adequate safety is: – ANS 4:1
Periodic evaluations and surveys of work practices are which type of
indicators of an organization’s safety performance? – ANS Leading
The three basic choices for applying anthropometric data to the design of
the work place include: – ANS Design for the average, extremes, and
range to allow for adjustability.
Which MOST influences an employee’s ability to dissipate body heat while
working in hot environments? – ANS Sweat production and evaporation
Human-machine interface design principals should incorporate: – ANS
Compatibility, coding, and arrangement.
Measuring physical and mental capabilities and assuring the safety of the
worker and the public is the purpose of: – ANS Fitness-for-duty exams.
Ergonomic tasks demands typically fall into three categories including: –
ANS Physical, environmental, and mental.
Strength, reflexes, and eye-hand coordination tend to decrease with a(n): –
ANS Aging workforce.
Which tool provides evaluations of force, posture, and duration for the
neck, trunk, and upper arms coupled with muscle function and physical
loads on the body? – ANS Rapid Upper Limb Assessment (RULA)
The PRIMARY solution to avoiding lifting injuries is to: – ANS Eliminate
lifting.
After all options to automate or mechanize equipment are exhausted,
companies may then have to utilize manual materials handling. When
managing the movement of materials, make sure the materials handled are:
- ANS Predominately on a horizontal plane.
Which is an administrative control aimed at improving the physical
capabilities of an individual aiming to reduce injuries? – ANS Work
Hardening
Which disease often affects the lungs of construction workers doing
remodeling and repairs of bridges and older structures? – ANS
Histoplasmosis
Biological hazard exposures controlled by safe work practices, safety
equipment use, and facility design are examples of: – ANS Containment
Ingestion of hazardous materials can be sourced to the workplace if
workers do not follow: – ANS Requirements for the separation of
foodstuffs from chemicals.
ASP exam
What are the three main security responsibilities? – ANS 1. Identify the
Restricted Area
- Protect the Restricted Area
- Control Access to the Restricted Area
What is the example of protecting the Restricted Area? – ANS Physical
barriers
What is used to identify the restricted area? – ANS Signage
What are examples of control access to the restricted area? – ANS ACOs,
CATSA
Who screens passengers, baggage’s and employees? – ANS CATSA
Who regulates and audits all agencies for compliance with governmental
regulations? – ANS Transport Canada
Who operates the Airport (designates, protects and controls access to
restricted areas) ? – ANS GTAA
Who enforces criminal code and responds to silent alarms? – ANS Police
Who processes people and goods that are entering Canada from abroad? –
ANS CBSA (Canada Customs)
Who processes people and goods that are entering USA from Canada? –
ANS U.S. CBP (U.S. Customs)
What does PBS and NPS stand for? – ANS Pre-board screening
Non-passenger screening
What are the three governmental legislations? – ANS 1. Aeronautics Act
2.Canadian Aviation Security Regulations
- Aerodrome Security Measures
What must be present to properly gain access into restricted area? – ANS
Need and right of entry
What is considered a need? – ANS As an employee, a need is work-related
What is considered a right? – ANS A physical document, like an airport
pass or RAIC
A right is a documented entitlement, how much are there? – ANS There
are 11 in total
How many valid reasons are there for employees to enter the restricted
area? – ANS Only one valid reason, it must be work-related
What is breach of security? – ANS Someone entering restricted area
without need or right
Which act governs and regulates civil aviation in Canada? – ANS
Aeronautics Act
What are the two main areas of the airport? – ANS Public and restricted
areas
What is a PSL and what is it responsible for? – ANS It is a primary
security line, responsible for creating a boundary between restricted area
and public area
What are the two main responsibilities of the PSL? – ANS 1. Separates
public area from restricted area
- Designates a restricted area
Fence, door or wall indicated by a sign are examples of ? – ANS PSL
What are the three restricted areas? – ANS 1. Sterile areas - Airside areas
- Baggage make-up areas (the areas where checked baggage is sorted
before being loaded onto aircraft)
What are the three types of sterile areas? – ANS 1. Domestic - International
- Trans-boarder
Which airport area does an access control officer control access to? – ANS
Restricted Area
ASP FINAL REVIEW
A document that gives travel information, such as flight arrival and
departure times and hotel reservations, is a(n): – ANS Itinerary
Administrative professionals need – ANS Interpersonal skills,
communication skills, and a strong work ethic.
A lawyer or architect is an example of a: – ANS Subject-matter expert
Being well-groomed means: – ANS Wear simple, professional shoes.
Which of the following is not a core value? – ANS Intelligence
Cross – functional teams: – ANS Have a matrix structure.
A webinar is a(n) – ANS Seminar presented over the world wide web or
other networks.
Typically, the most efficient method of making flight reservations is by: –
ANS The Internet.
Which of the following our storage options for backing up electronics
records you create? – ANS Flash drive, network drive, storage location in
the cloud
When members of the team perceive that another member is not doing his
or her work, what is the result? – ANS Mistrust.
Which storage method uses the letters of the alphabet to the term in the
order in which a record is filed? – ANS Alphabetic storage method.
Offering fair and a equitable pay is: – ANS And ethical way to treat
employees; in the best interest of the company.
Two or more telephones, computers, or other devices connected for
purposes of communicating and sharing resources is a(n): – ANS Network
To manage your relationships at work: – ANS Take time to think about
yourself.
ASP Final – 76 Questions from Exams
all correctly answered
DNA codes for proteins that have specific functions, the proteins of interest in drug
therapy include what? Correct Answer: Receptors, transporters, metabolizing
enzymes
The DNA sequencing method with the synonyms “Sanger method” and “chain
terminating method” is based on what? Correct Answer: Incorporation of a
dideoxynucleotide in the chain
Gel electrophoresis relative to strands of DNA can do what? Correct Answer:
Separate DNA strands by as little as one nucleoside base
In amplification of DNA, what is required to initiate the formation of
complementary (or daughter) DNA strands from the template strand? Correct
Answer: Primers
Why do DNA “chain terminators” stop the expansion of a DNA strand? Correct
Answer: They lack the 3′ hydroxyl group
Strand 1: GCCGTCGTAACGGG
Strand 2: ACGGGCTCTGTCAGGTCGTCCA
Strand 3: GTCCAGTCGATGGCCTT
If the last base in each strand were the terminal base with a fluorescent dye
attached, what would the DNA sequence be, once the strands passed through a gel
electrophoresis system? Correct Answer: GTA
The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to
3.7]. What is the association/correlation between coffee and cancer? Correct
Answer: There is no association between coffee and stomach cancer based on this
data
What is the best measure to compare the outcomes among various different studies
to create a level playing field for looking at the results? Correct Answer: Number
needed to treat
ASP FINAL 76+ QUESTIONS &
ANSWERS A+ GRADED
Parametric statistics require 2 assumptions to be utilized appropriately by a
researcher. One assumption is that the data must be interval level data. What is the
other assumption? Correct Answer: Normally distributed or sample size greater
than or equal to 30
The gold standard of OBSERVATIONAL study designs that measures TRUE rate
(relative risk) rather than estimating the rate is? Correct Answer: Cohort
What is the odds ration an estimate of? Correct Answer: Relative risk
What is a study that reflects more of the real world setting and includes patients
with more than one disease state? Correct Answer: Effectiveness study
When will you not float at the surface of a fresh water lake? Correct Answer:
When your average body density is less than the density of fresh water
A neuron star has a mass of 2.50 x 10^28 kg and a density of 3.93 x 10^18 kg/m^3.
What is its volume? Correct Answer: 6.36 x 10^9 m^3
You are lying down on a bed of 3000 nails (I’m not sure why). Your body weight of
695 N is evenly distributed among the nails. Each nail has a tip diameter of 1.00
nm. What is the pressure at each nail point? Correct Answer: 2.95 x 10^5 Pa
For a hydraulic lift in a car garage designed to lift up a car using a relatively small
input force, what must be true about the force and pressure on the input versus the
output piston? Correct Answer: The force on the input piston is less than the force
on the output piston.
The pressure on the input piston is equal to the pressure on the output piston.
What is Archimedes’ principle? Correct Answer: An object submerged (partially or
wholly) in a fluid experiences an upward buoyant force. The buoyant force is equal
in magnitude to the weight of the fluid displaced by the object.
An athlete is weighted in the air and then in water. Assume that the athlete is
completely submerged in the fluid while weighing is done. the scale reading in air
was 750 N. The athlete’s average body density was determined to be 1.04 x 10^3
kg/m^3. What’s the volume of the athlete’s body and the athlete’s apparent weight
in water (the scale’s reading in water)? Correct Answer: 0.0736 m^3
29.0 N
ASP Exam| 685 Questions
with 100% Correct Answers
Presbycusis Correct Answer: Hearing loss due to old age
Presbyopia Correct Answer: impaired vision as a result of aging, difficulty
focusing
Byssinosis Correct Answer: Disease from inhaling cotton fibers. Also called
“brown lung disease” or “Monday fever”. Reaction against cotton, linen, hemp
products in textile/fabric industry.
Four (4) types of human errors discussed in Human Factors Engineering. Correct
Answer: “Errors C.O.S.T. time and money”
- Commission: doing something wrong
- Omission: leaving something out
- Sequence: doing something in the wrong order
- Timing: doing something out of allotted time, too fast or too slow
Does the employers have to post OSHA citations? Correct Answer: Yes, for 3 days
or until corrected.
Audiogram Correct Answer: Written record of hearing threshold at specified
frequencies.
Audiometer Correct Answer: a device that can present tones of different
frequencies, from low in pitch to high in pitch, at different volumes from soft to
loud
What dB at 3000 hz during an audiogram means the person can’t hear the tone?
Correct Answer: 30 dB
Factors that affect absorption of noise Correct Answer: angle to noise source,
frequency of noise, density, condition/cleanliness, type of mounting, shape of
surface
ASP EXAM 685 + QUESTIONS &
ANSWERS 2023 A+ GRADED 10%
VERIFIED
To improve noise absorption through engineering controls, what properties do you
want? Correct Answer: Good porosity, thickness, air gaps
Emissivity Correct Answer: Ratio of radiation emitted by a surface to the radiation
emitted by a black body at the same temperature. A black body is 1.0 (highest),
down to 0 (bright, reflective surfaces).
Emissivity of bright metal surfaces Correct Answer: Low – less than 0.1 (bright
metal is a good reflector), meaning it is good for reducing radiant heat.
Emissivity of unpolished surfaces Correct Answer: Close to 1.0, which is high,
meaning not great for reducing radiant heat.
Carpal tunnel affects what nerve and what parts of the hand? Correct Answer:
Median nerve. Thumb, pointer and ring fingers, NOT the pinky. Inflammation and
pain in the wrist. Thenar wasting is sign of advanced disease.
Metal Fume Fever Correct Answer: Acute condition from brief high exposure to
metal fumes (e.g., zinc, magnesium, their oxides). Symptoms appear from 4 to 12
hours after exposure — fever, shaking chills (flu-like). Recovery is quick. Workers
can develop immunity, but a break and re-exposure normally makes it worse.
What do altitude changes affect (and not affect) regarding fans? Correct Answer:
Horsepower needed (air has less mass), static pressure (not as much needed). But
the CFM (volumetric rate) is NOT changed by altitude, and neither is RPM of the
fan.
SCBA & airline respirator rules Correct Answer: Must be Grade D or higher; can
use high pressure air; oil pumped with filtering is acceptable. Medical oxygen is
NOT allowed – dangerous because of increased flammability.
Abduction, adduction, flexion, extension Correct Answer: Adbuction: increasing
angle of arm to body, AWAY.
Adduction: decreasing angle of arm to body, TOWARD.
Extension: increasing angle of forearm to bicep.
Flexion: decreasing angle of forearm to bicep.
Grade D breathing air Correct Answer: 19.5%-23.5% oxygen
<5 mg/m3 of oil
<10 ppm CO
<1000 ppm CO2.
TLV, PEL, IDLH for carbon monoxide Correct Answer: TLV of 50 ppm (ACGIH);
STEL of 400.
IDLH of 1500 ppm (NIOSH)
PEL of 35-50 (OSHA); ceiling is 200, instantaneous is 1500.
Carbon Monoxide (CO) Correct Answer: Air pollution that is a product of
combustion of fossil fuels. Flammable, colorless, odorless, poisonous. Chemical
asphyxiate. Does NOT harm red blood cells, but reduces their oxygen-carrying
capacity.
Teratogen Correct Answer: an agent or factor that causes malformation of an
embryo or fetus. Does not propagate across generational lines.
Next best option to electric forklifts for emissions. Correct Answer: Convert the
forklift to LP gas.
Double insulation does not protect against shock in what circumstance? Correct
Answer: Water, wet locations
(Data terms) Random, stratified, systematic, cluster Correct Answer: Random:
everyone has an equal change. Stratified: separated by layers. Systematic:
patterned response. Cluster: confined to a location.
pH less than 7 Correct Answer: acid
pH greater than 7 Correct Answer: base
activated carbon Correct Answer: A form of specially treated, porous carbon, used
to absorb various odors and vapors. Has a non-polar surface.
Axial flow fans Correct Answer: High volume and low pressure drop; general &
dilution ventilation; NOT good for LEV; NOT used to move air through a duct;
sometimes used for comfort.
Centrifugal fans Correct Answer: Fan axis is perpendicular to flow — spits air out
90 degrees. Low noise. Suited to high pressures. Low to moderate static pressures;
used in heating & air conditioning; workhorse of industrial hygiene; sometimes
called squirrel cages; good for lint, wood chips & dust.
Forward blades in centrifugal fan Correct Answer: Blades are curved in the
direction of rotation. Used whenever a large air volume has to be moved in a tight
space. Requires more power, which can overload motors.
Backward blades in centrifugal fan Correct Answer: Blades are curved in the
opposite direction of rotation. More efficient than forward blades.
Paddle wheel or long-shaving wheel Correct Answer: Used with medium tip speed
for buffing exhaust, woodworking exhaust or when heavy dust must pass through
the fan.
Max travel distance of fire extinguisher in light hazard occupancies Correct
Answer: 75 ft. Includes places like churches, clubs, education centers, kennels,
museums, homes.
Inspection items for self-closing doors Correct Answer: 1) Lubrication on guides
& bearings
2) Binders are not bent, thus obstructing door
3) Chains/wire ropes have not stretched.
4) Fusible links are NOT painted.
Main cause of sprinkler system failure Correct Answer: 35% of the time: closed
water-supply valves.
Main cause of leaking sprinkler heads Correct Answer: Overheating from being
too close to heat-generating processes.
How often should sound level meters be calibrated? Correct Answer: Before &
after each survey
Particle sizes Correct Answer: Large: silica
Small: zinc
Safest method to determine electrical current Correct Answer: Split-core ammeter
Treating exposure to liquid oxygen Correct Answer: Warm water. Never rub or use
dry heat. Frozen tissue is painless but will be swollen & painful when thawed.
ASP Exam Preparation| 192 Questions
with 100% Correct Answers
Workers Comp – low fence Correct Answer: minimum dB loss before a worker is
eligible for compensation, because small hearing losses aren’t debilitating
Workers Comp – high fence Correct Answer: 100% hearing loss
Time-Loss Analysis Correct Answer: Technique that is based on the premise of a
natural course line for accidents –that is, with no outside intervention, each
accident sequence would eventually end.
Attractive Nuisance Doctrine Correct Answer: A person is under the duty to
prevent injury to children that may be attracted to something which could cause
harm
Business interruption recovery/business continuity Correct Answer: Allows
facility to continue serving its customers even though the facility was nearly
destroyed by a fire
Contributory negligence Correct Answer: When an injured person’s care for his
own safety was less than that reasonable for a prudent person under existing
conditions
Fright without physical contact Correct Answer: Neurological or emotional
disturbances that occurred without physical injury
Foreseeability applied to rescue Correct Answer: allows damages to rescuer if
someone could have foreseen that their actions were going to cause an incident
where aid would be needed
Obvious peril Correct Answer: A manufacturer is not required to warn prospective
users of products whose use involves an obvious peril, especially those that are
well known to the general public
Strict liability Correct Answer: Manufacturer of a product is liable for injuries due
to defects, no proof needed of negligence or fault
ASP EXAM 192 + QUESTIONS &
ANSWERS 2023 A+ GRADED 100%
VERIFIED
Dangerous Instrumentality Correct Answer: A person who keeps, maintains,
transports, or stores a dangerous creature, device or substance is liable for injury or
damage, regardless of fault, even when he exercises due care
Great care Correct Answer: High degree of care that a very prudent and cautious
person would undertake for the safety of others — (bus, trains, airplanes).
Res ipsa loguitur Correct Answer: occurrence of an accident is sufficient proof
that negligence existed
Sneak circuit analysis Correct Answer: A technique which is used to determine an
unintended energy route, which can allow an undesired function to occur, prevent
desired functions from occurring, or adversely affect the timing of functions
HAZOP Analysis Correct Answer: Multi-disciplinary team to brainstorm and
identify the consequences of deviations from design intent. Uses guide words
Failure modes effects analysis – FMEA Correct Answer: Classic inductive
reasoning process. Failure or malfunction of each component is considered and the
effects of the failure traced throughout the system
Fault tree analysis Correct Answer: Classic deductive reasoning process. Selects
the undesired outcome and all possible modes of happenings
Cut Set Correct Answer: Shortest path to failure in a fault tree
Velocity of discharge from a fire extinguisher Correct Answer: Q = 12.1 * square
root of P, Q = velocity of discharge, P = pressure in PSI
ASME and API Standard 620 Correct Answer: Code(s) utilized in the design and
construction of pressure vessels
Flow rate (in gpm) of water from fire hydrant Correct Answer: Q= k * square root
of P; “k factor” will be specific to the type of hydrandt
Pre-action sprinkler system Correct Answer: Water supply is activated by a a fire
alarm system. Protects against damage if to building if sprinkler pipes/heads leak