{"id":117654,"date":"2023-08-29T17:20:06","date_gmt":"2023-08-29T17:20:06","guid":{"rendered":"https:\/\/learnexams.com\/blog\/?p=117654"},"modified":"2023-08-29T17:20:09","modified_gmt":"2023-08-29T17:20:09","slug":"asp-bundle-actual-exams-2023-actual-tests-full-packaged-solution-all-here-a-graded-100-verified","status":"publish","type":"post","link":"https:\/\/www.learnexams.com\/blog\/2023\/08\/29\/asp-bundle-actual-exams-2023-actual-tests-full-packaged-solution-all-here-a-graded-100-verified\/","title":{"rendered":"ASP BUNDLE || ACTUAL EXAMS 2023|| ACTUAL TESTS|| FULL PACKAGED SOLUTION|| ALL HERE!! ( A+ GRADED 100% VERIFIED)"},"content":{"rendered":"\n<p>ASP Associate Safety Professional Exam<br>A 40 ton gantry crane has been out of service for more than 6 months for<br>structural repair. It is required to be proof tested at <strong><em><strong><em>?? Before being used? &#8211; ANS 50 tons A body that has a definite volume but no definite shape is? &#8211; ANS A liquid A cage on a fixed ladder on a commercial ladder cannot extend any closer than how many feet from the ground? &#8211; ANS OSHA 1910.27 &#8220;cages shall extend down the ladder to a point of not less than 7 feet or more than 8 feet above the base of the ladder&#8221;. &#8220;A calorie is the amount of heat required to raise the temperature of one gram of water ____<\/em><\/strong><\/em><\/strong><br>BTU is the measure of energy and is the amount of heat required to raise<br>temperature of one pound of water_______&#8221; &#8211; ANS &#8220;1 degree Celsius<\/p>\n\n\n\n<p>1 degree Farenheit<br>&#8220;<br>A commercial motor vehicle transporting hazardous materials is required<br>to display placards in which of the following locations? &#8211; ANS Front, rear<br>and both sides of vehicle<br>A fire resistive wall separating oxygen and fuel gases should be how high?<\/p>\n\n\n\n<ul class=\"wp-block-list\">\n<li>ANS About five feet<br>A room designed for recharging of lead acid batteries does not require?? &#8211;<br>ANS Pressure relief panels<br>A solution contains 10-2 hydrogen ions per liter. What would this solution<br>be considered? &#8211; ANS A strong acid<br>Acclimatization to heat is generally achieved by requiring the employee to?<\/li>\n\n\n\n<li>ANS Work for two hours per day for two weeks.<\/li>\n<\/ul>\n\n\n\n<p>New workers and those returning from a prolonged absence should begin<br>with <em>20%<\/em> of the workload on the first day, increasing incrementally by no<br>more than <em>20%<\/em> each subsequent day.<br>During a rapid change leading to excessively hot weather or conditions<br>such as a <em>heat wave<\/em>, even experienced workers should begin on the first<br>day of work in excessive heat with <em>50%<\/em> of the normal workload and time<br>spent in the hot environment, <em>60%<\/em> on the second day, <em>80%<\/em> on day three,<br>and <em>100%<\/em> on the fourth day. <em>Full acclimatization<\/em> may take up to <em>14 days<\/em> or longer depending on factors relating to the individual, such as<br>increased risk of heat illness due to certain medications or medical<br>conditions, or the environment.<br>According to 1910.145, what is the minimum reading distance when posting<br>a danger sign? &#8211; ANS Five feet<br>According to ANSI Z89.1-1997 specifications for helmets (hardhats) to<br>protect employees from impact of falling objects and from high voltage<br>electrical shock. Which of the following classes offer low voltage<br>protection? &#8211; ANS G<\/p>\n\n\n\n<p>According to OSHA 1910.217 &#8220;Mechanical Power Press&#8221; requires how<br>much safe distance per second of stopping time from &#8220;point of operation<br>devices&#8221; to ensure the safety of the operator? &#8211; ANS 63 inches or 5.25<br>feet<br>According to OSHA HAZ Com; who has the responsibility to determine if a<br>material is hazardous? &#8211; ANS The manufacturer or importer of the<br>chemical<br>According to the Commercial Motor Vehicle Safety Act of 1986, a CDL is<br>required for what operation?? &#8211; ANS Single vehicle with a GVW of<br>26,000lbs.<br>According to the fire protection handbook, although increasing storage<br>heights increases fire intensity, storage heights up to <strong><em>_ feet in piled storage and up to __<\/em><\/strong> feet in rack storage need not be adjusted. &#8211; ANS<br>&#8220;12 feet for piled<br>15 feet for rack storage<\/p>\n\n\n\n<p>ASP CSP<br>Risk &#8211; ANS The measure of the probability and severity of a negative<br>event<br>Probability &#8211; ANS How likely the event is to occur. This includes<br>exposure, the more people exposed the more likely the event.<br>Risk Management Process &#8211; ANS 1 Evaluate (Risk ID)<br>2 Prioritize (Risk Analysis)<br>4 Cost Benefit (Financing)<br>4 Implement (Risk Elimination or Reduction)<br>5 (Administration of Risk Management Process)<br>Review<br>Objective evidence which is documentation<br>Healthy Worker Effect &#8211; ANS Workers tend to be healthier than the<br>population as a whole.<br>Risk Cost &#8211; ANS Probability x Cost<\/p>\n\n\n\n<p>Residual Risk &#8211; ANS The Risk that remains after the preventative measure<br>have been taken<br>Threshold Risk Model &#8211; ANS ACGIH<br>There is some safe level to which everyone can be exposed without<br>increasing the probability of becoming sick.<br>No Threshold Risk Model &#8211; ANS There is no safe level. Every exposure<br>increase probability of becoming sick (ionizing rad)<br>ALAR<br>ALARA &#8211; ANS As Low As Reasonably Achievable<br>Purpose of Incident Investigation &#8211; ANS To prevent re-occurance, retro<br>active, to find facts &#8211; not to place blame.<br>Notes: Good apple bad apple by Dekker.<br>OSHA incident rate<br>Total incident case rate &#8211; ANS total injuries\/illness x 200,000\/Hrs worked<br>by all employees<\/p>\n\n\n\n<p>ASP Exam Prep<br>Which type of machine guarding technique requires the least amount of<br>participation from employees? &#8211; ANS Physical Guard<br>According to Maslow&#8217;s Hierarchy of Needs, what must be met before one&#8217;s<br>safety needs can be met? &#8211; ANS Human Metabolic Requirements<br>Maslow&#8217;s hierarchy of needs &#8211; ANS physiological (human metabolic<br>requirements), safety, love\/belonging, esteem, self-actualization<br>Most effective method for controlling exposures to airborne asbestos fibers<br>during the removal of asbestos insulation &#8211; ANS Wet the insulation<br>thoroughly prior to removal<br>respirator for asbestos removal &#8211; ANS negative pressure, air-purifying<br>respirators with HEPA filters<br>Teratogen &#8211; ANS a substance that crosses the placenta and harms the<br>fetus<\/p>\n\n\n\n<p>How much heat would be released from the complete combustion of a 5 gal<br>container of gasoline. Density = 6.073 lbs\/gas; heating value= 18,772<br>BTU\/lb &#8211; ANS 570,012 BTU<br>In a Fault Tree analysis, the house shape indicates what? &#8211; ANS events<br>that are expected to occur under normal circumstances<br>Fault Tree Analysis &#8211; ANS a visual method for analyzing the<br>interrelationships among failures; top down, deductive failure analysis in<br>which an undesired state of a system is analyzed using Boolean logic to<br>combine a series of lower-level events<br>What is the most important duty of the safety manager at a facility? &#8211; ANS<br>Being a risk assessment resource to the management team<br>When using fire extinguishers, a common mnemonic device is &#8220;P-A-S-S&#8221;.<br>What does the &#8220;A&#8221; in PASS stand for? &#8211; ANS Aim. Pull Aim Squeeze<br>Sweep<\/p>\n\n\n\n<p>Minimum Sample volume is equal to what? &#8211; ANS Limit of quantification<br>(LOQ) times 1,000 divided by the contaminant target concentration<br>An object of mass 92 kg rolls down a hill at 9.1 m\/s. Calculate the<br>momentum of the object. p=mv &#8211; ANS 837.2 kg x m\/s (p=mv ; m=mass (kg)<br>; v=velocity (m\/s)<br>&#8220;White Finger&#8221; is an injury that can result from what? &#8211; ANS Vibration.<br>Disorder that affects the blood vessels, nerves, muscles, and joints of the<br>hand, wrist, and arm. White finger can cause poor blood circulation,<br>causing skin to become pale or waxy<br>What is the purpose of the Water Armor or &#8220;Turtle Suit&#8221; &#8211; ANS To protect<br>the body from high pressure blasts. Suit protects the chest, legs, and arms<br>from glancing blows of up to 40,000 psi<br>Which disease was once the leading cause of death in the United States? &#8211;<br>ANS Tuberculosis. Disease that attacks the lungs and other parts of the<br>body, spread through the air when infected people cough, sneeze, or spit<\/p>\n\n\n\n<p>Paralysis, hallucinations, and hyper-salivation are all potential symptoms<br>of what disease? &#8211; ANS Rabies<br>What is the primary purpose of training? &#8211; ANS To solve a problem in the<br>workplace. Safety training program should be a well thought out and a<br>needs analysis should be performed<br>Computer based training is most helpful for what type of delivery method &#8211;<br>ANS Self-paced learning<br>Employees should be involved in audits when possible for what reasons &#8211;<br>ANS Workers are most in contact with potential safety\/health hazards,<br>Employees are more likely to support and use programs in which they have<br>input, groups have a wider range of experience than individuals<br>You have three resistors valued respectively at 5\u03a9, 7\u03a9, and 10\u03a9 in a<br>parallel circuit. What is the total resistance of the circuit?<br>1\/Rparallel=1\/R1 + 1\/R2 + 1\/Rn &#8211; ANS 2.27 (1\/Rparallel = 0.2 + 0.14 + 0.1<br>1\/Rparallel = 0.44<br>Rparallel=1\/0.44-2.27)<\/p>\n\n\n\n<p>ASP Prep<br>Rust, the most common kind of corrosion, is the action of which element<br>on iron or aluminum? &#8211; ANS Oxygen<br>Isopropyl alcohol has a flammability range between 2% and 12%; therefore,<br>the Upper Explosive Limit is: &#8211; ANS 12% alcohol in air<br>A worker&#8217;s exposure to an airborne contaminant in any 8-hour work shift of<br>any 40-hour work week is known as the: &#8211; ANS Time weighted average.<br>Calculating radioactive decay requires information on the initial quantity of<br>materials, quantity of material at the time of measurement, time interval<br>between the measurements, and the: &#8211; ANS Radioactive decay constant<br>for the materials.<br>The statistically determined time interval for a radioactive isotope to decay<br>by 50% is called the: &#8211; ANS Half life of the material.<br>Boyle&#8217;s law is expressed as: &#8211; ANS P1V1 = P2V2.<\/p>\n\n\n\n<p>Often described as predictive, preventative, or proactive, which are tools<br>designed to measure the improvement of safety and health initiatives? &#8211;<br>ANS Behavior, condition, standard<br>Radiation strength or activity is often measured in: &#8211; ANS Curie.<br>Current equals voltage divided by the: &#8211; ANS Resistance<br>What happens to the sling tension of a rigged load when the sling angle<br>from the vertical is increased? &#8211; ANS The sling tension increases.<br>The proper angle to place a ladder to ensure adequate safety is: &#8211; ANS 4:1<br>Periodic evaluations and surveys of work practices are which type of<br>indicators of an organization&#8217;s safety performance? &#8211; ANS Leading<br>The three basic choices for applying anthropometric data to the design of<br>the work place include: &#8211; ANS Design for the average, extremes, and<br>range to allow for adjustability.<\/p>\n\n\n\n<p>Which MOST influences an employee&#8217;s ability to dissipate body heat while<br>working in hot environments? &#8211; ANS Sweat production and evaporation<br>Human-machine interface design principals should incorporate: &#8211; ANS<br>Compatibility, coding, and arrangement.<br>Measuring physical and mental capabilities and assuring the safety of the<br>worker and the public is the purpose of: &#8211; ANS Fitness-for-duty exams.<br>Ergonomic tasks demands typically fall into three categories including: &#8211;<br>ANS Physical, environmental, and mental.<br>Strength, reflexes, and eye-hand coordination tend to decrease with a(n): &#8211;<br>ANS Aging workforce.<br>Which tool provides evaluations of force, posture, and duration for the<br>neck, trunk, and upper arms coupled with muscle function and physical<br>loads on the body? &#8211; ANS Rapid Upper Limb Assessment (RULA)<br>The PRIMARY solution to avoiding lifting injuries is to: &#8211; ANS Eliminate<br>lifting.<\/p>\n\n\n\n<p>After all options to automate or mechanize equipment are exhausted,<br>companies may then have to utilize manual materials handling. When<br>managing the movement of materials, make sure the materials handled are:<\/p>\n\n\n\n<ul class=\"wp-block-list\">\n<li>ANS Predominately on a horizontal plane.<br>Which is an administrative control aimed at improving the physical<br>capabilities of an individual aiming to reduce injuries? &#8211; ANS Work<br>Hardening<br>Which disease often affects the lungs of construction workers doing<br>remodeling and repairs of bridges and older structures? &#8211; ANS<br>Histoplasmosis<br>Biological hazard exposures controlled by safe work practices, safety<br>equipment use, and facility design are examples of: &#8211; ANS Containment<br>Ingestion of hazardous materials can be sourced to the workplace if<br>workers do not follow: &#8211; ANS Requirements for the separation of<br>foodstuffs from chemicals.<\/li>\n\n\n\n<li><\/li>\n<\/ul>\n\n\n\n<p>ASP exam<br>What are the three main security responsibilities? &#8211; ANS 1. Identify the<br>Restricted Area<\/p>\n\n\n\n<ol class=\"wp-block-list\" start=\"2\">\n<li>Protect the Restricted Area<\/li>\n\n\n\n<li>Control Access to the Restricted Area<br>What is the example of protecting the Restricted Area? &#8211; ANS Physical<br>barriers<br>What is used to identify the restricted area? &#8211; ANS Signage<br>What are examples of control access to the restricted area? &#8211; ANS ACOs,<br>CATSA<br>Who screens passengers, baggage&#8217;s and employees? &#8211; ANS CATSA<br>Who regulates and audits all agencies for compliance with governmental<br>regulations? &#8211; ANS Transport Canada<\/li>\n<\/ol>\n\n\n\n<p>Who operates the Airport (designates, protects and controls access to<br>restricted areas) ? &#8211; ANS GTAA<br>Who enforces criminal code and responds to silent alarms? &#8211; ANS Police<br>Who processes people and goods that are entering Canada from abroad? &#8211;<br>ANS CBSA (Canada Customs)<br>Who processes people and goods that are entering USA from Canada? &#8211;<br>ANS U.S. CBP (U.S. Customs)<br>What does PBS and NPS stand for? &#8211; ANS Pre-board screening<br>Non-passenger screening<br>What are the three governmental legislations? &#8211; ANS 1. Aeronautics Act<br>2.Canadian Aviation Security Regulations<\/p>\n\n\n\n<ol class=\"wp-block-list\" start=\"3\">\n<li>Aerodrome Security Measures<br>What must be present to properly gain access into restricted area? &#8211; ANS<br>Need and right of entry<\/li>\n<\/ol>\n\n\n\n<p>What is considered a need? &#8211; ANS As an employee, a need is work-related<br>What is considered a right? &#8211; ANS A physical document, like an airport<br>pass or RAIC<br>A right is a documented entitlement, how much are there? &#8211; ANS There<br>are 11 in total<br>How many valid reasons are there for employees to enter the restricted<br>area? &#8211; ANS Only one valid reason, it must be work-related<br>What is breach of security? &#8211; ANS Someone entering restricted area<br>without need or right<br>Which act governs and regulates civil aviation in Canada? &#8211; ANS<br>Aeronautics Act<br>What are the two main areas of the airport? &#8211; ANS Public and restricted<br>areas<\/p>\n\n\n\n<p>What is a PSL and what is it responsible for? &#8211; ANS It is a primary<br>security line, responsible for creating a boundary between restricted area<br>and public area<br>What are the two main responsibilities of the PSL? &#8211; ANS 1. Separates<br>public area from restricted area<\/p>\n\n\n\n<ol class=\"wp-block-list\" start=\"2\">\n<li>Designates a restricted area<br>Fence, door or wall indicated by a sign are examples of ? &#8211; ANS PSL<br>What are the three restricted areas? &#8211; ANS 1. Sterile areas<\/li>\n\n\n\n<li>Airside areas<\/li>\n\n\n\n<li>Baggage make-up areas (the areas where checked baggage is sorted<br>before being loaded onto aircraft)<br>What are the three types of sterile areas? &#8211; ANS 1. Domestic<\/li>\n\n\n\n<li>International<\/li>\n\n\n\n<li>Trans-boarder<br>Which airport area does an access control officer control access to? &#8211; ANS<br>Restricted Area<\/li>\n<\/ol>\n\n\n\n<p>ASP FINAL REVIEW<br>A document that gives travel information, such as flight arrival and<br>departure times and hotel reservations, is a(n): &#8211; ANS Itinerary<br>Administrative professionals need &#8211; ANS Interpersonal skills,<br>communication skills, and a strong work ethic.<br>A lawyer or architect is an example of a: &#8211; ANS Subject-matter expert<br>Being well-groomed means: &#8211; ANS Wear simple, professional shoes.<br>Which of the following is not a core value? &#8211; ANS Intelligence<br>Cross &#8211; functional teams: &#8211; ANS Have a matrix structure.<br>A webinar is a(n) &#8211; ANS Seminar presented over the world wide web or<br>other networks.<\/p>\n\n\n\n<p>Typically, the most efficient method of making flight reservations is by: &#8211;<br>ANS The Internet.<br>Which of the following our storage options for backing up electronics<br>records you create? &#8211; ANS Flash drive, network drive, storage location in<br>the cloud<br>When members of the team perceive that another member is not doing his<br>or her work, what is the result? &#8211; ANS Mistrust.<br>Which storage method uses the letters of the alphabet to the term in the<br>order in which a record is filed? &#8211; ANS Alphabetic storage method.<br>Offering fair and a equitable pay is: &#8211; ANS And ethical way to treat<br>employees; in the best interest of the company.<br>Two or more telephones, computers, or other devices connected for<br>purposes of communicating and sharing resources is a(n): &#8211; ANS Network<br>To manage your relationships at work: &#8211; ANS Take time to think about<br>yourself.<\/p>\n\n\n\n<p>ASP Final &#8211; 76 Questions from Exams<br>all correctly answered<br>DNA codes for proteins that have specific functions, the proteins of interest in drug<br>therapy include what? Correct Answer: Receptors, transporters, metabolizing<br>enzymes<br>The DNA sequencing method with the synonyms &#8220;Sanger method&#8221; and &#8220;chain<br>terminating method&#8221; is based on what? Correct Answer: Incorporation of a<br>dideoxynucleotide in the chain<br>Gel electrophoresis relative to strands of DNA can do what? Correct Answer:<br>Separate DNA strands by as little as one nucleoside base<br>In amplification of DNA, what is required to initiate the formation of<br>complementary (or daughter) DNA strands from the template strand? Correct<br>Answer: Primers<br>Why do DNA &#8220;chain terminators&#8221; stop the expansion of a DNA strand? Correct<br>Answer: They lack the 3&#8242; hydroxyl group<br>Strand 1: GCCGTCGTAACGGG<br>Strand 2: ACGGGCTCTGTCAGGTCGTCCA<br>Strand 3: GTCCAGTCGATGGCCTT<br>If the last base in each strand were the terminal base with a fluorescent dye<br>attached, what would the DNA sequence be, once the strands passed through a gel<br>electrophoresis system? Correct Answer: GTA<br>The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to<br>3.7]. What is the association\/correlation between coffee and cancer? Correct<br>Answer: There is no association between coffee and stomach cancer based on this<br>data<br>What is the best measure to compare the outcomes among various different studies<br>to create a level playing field for looking at the results? Correct Answer: Number<br>needed to treat<br>ASP FINAL 76+ QUESTIONS &amp;<br>ANSWERS A+ GRADED<\/p>\n\n\n\n<p>Parametric statistics require 2 assumptions to be utilized appropriately by a<br>researcher. One assumption is that the data must be interval level data. What is the<br>other assumption? Correct Answer: Normally distributed or sample size greater<br>than or equal to 30<br>The gold standard of OBSERVATIONAL study designs that measures TRUE rate<br>(relative risk) rather than estimating the rate is? Correct Answer: Cohort<br>What is the odds ration an estimate of? Correct Answer: Relative risk<br>What is a study that reflects more of the real world setting and includes patients<br>with more than one disease state? Correct Answer: Effectiveness study<br>When will you not float at the surface of a fresh water lake? Correct Answer:<br>When your average body density is less than the density of fresh water<br>A neuron star has a mass of 2.50 x 10^28 kg and a density of 3.93 x 10^18 kg\/m^3.<br>What is its volume? Correct Answer: 6.36 x 10^9 m^3<br>You are lying down on a bed of 3000 nails (I&#8217;m not sure why). Your body weight of<br>695 N is evenly distributed among the nails. Each nail has a tip diameter of 1.00<br>nm. What is the pressure at each nail point? Correct Answer: 2.95 x 10^5 Pa<br>For a hydraulic lift in a car garage designed to lift up a car using a relatively small<br>input force, what must be true about the force and pressure on the input versus the<br>output piston? Correct Answer: The force on the input piston is less than the force<br>on the output piston.<br>The pressure on the input piston is equal to the pressure on the output piston.<br>What is Archimedes&#8217; principle? Correct Answer: An object submerged (partially or<br>wholly) in a fluid experiences an upward buoyant force. The buoyant force is equal<br>in magnitude to the weight of the fluid displaced by the object.<br>An athlete is weighted in the air and then in water. Assume that the athlete is<br>completely submerged in the fluid while weighing is done. the scale reading in air<br>was 750 N. The athlete&#8217;s average body density was determined to be 1.04 x 10^3<br>kg\/m^3. What&#8217;s the volume of the athlete&#8217;s body and the athlete&#8217;s apparent weight<br>in water (the scale&#8217;s reading in water)? Correct Answer: 0.0736 m^3<br>29.0 N<\/p>\n\n\n\n<p>ASP Exam| 685 Questions<br>with 100% Correct Answers<br>Presbycusis Correct Answer: Hearing loss due to old age<br>Presbyopia Correct Answer: impaired vision as a result of aging, difficulty<br>focusing<br>Byssinosis Correct Answer: Disease from inhaling cotton fibers. Also called<br>&#8220;brown lung disease&#8221; or &#8220;Monday fever&#8221;. Reaction against cotton, linen, hemp<br>products in textile\/fabric industry.<br>Four (4) types of human errors discussed in Human Factors Engineering. Correct<br>Answer: &#8220;Errors C.O.S.T. time and money&#8221;<\/p>\n\n\n\n<ol class=\"wp-block-list\">\n<li>Commission: doing something wrong<\/li>\n\n\n\n<li>Omission: leaving something out<\/li>\n\n\n\n<li>Sequence: doing something in the wrong order<\/li>\n\n\n\n<li>Timing: doing something out of allotted time, too fast or too slow<br>Does the employers have to post OSHA citations? Correct Answer: Yes, for 3 days<br>or until corrected.<br>Audiogram Correct Answer: Written record of hearing threshold at specified<br>frequencies.<br>Audiometer Correct Answer: a device that can present tones of different<br>frequencies, from low in pitch to high in pitch, at different volumes from soft to<br>loud<br>What dB at 3000 hz during an audiogram means the person can&#8217;t hear the tone?<br>Correct Answer: 30 dB<br>Factors that affect absorption of noise Correct Answer: angle to noise source,<br>frequency of noise, density, condition\/cleanliness, type of mounting, shape of<br>surface<br>ASP EXAM 685 + QUESTIONS &amp;<br>ANSWERS 2023 A+ GRADED 10%<br>VERIFIED<\/li>\n<\/ol>\n\n\n\n<p>To improve noise absorption through engineering controls, what properties do you<br>want? Correct Answer: Good porosity, thickness, air gaps<br>Emissivity Correct Answer: Ratio of radiation emitted by a surface to the radiation<br>emitted by a black body at the same temperature. A black body is 1.0 (highest),<br>down to 0 (bright, reflective surfaces).<br>Emissivity of bright metal surfaces Correct Answer: Low &#8211; less than 0.1 (bright<br>metal is a good reflector), meaning it is good for reducing radiant heat.<br>Emissivity of unpolished surfaces Correct Answer: Close to 1.0, which is high,<br>meaning not great for reducing radiant heat.<br>Carpal tunnel affects what nerve and what parts of the hand? Correct Answer:<br>Median nerve. Thumb, pointer and ring fingers, NOT the pinky. Inflammation and<br>pain in the wrist. Thenar wasting is sign of advanced disease.<br>Metal Fume Fever Correct Answer: Acute condition from brief high exposure to<br>metal fumes (e.g., zinc, magnesium, their oxides). Symptoms appear from 4 to 12<br>hours after exposure &#8212; fever, shaking chills (flu-like). Recovery is quick. Workers<br>can develop immunity, but a break and re-exposure normally makes it worse.<br>What do altitude changes affect (and not affect) regarding fans? Correct Answer:<br>Horsepower needed (air has less mass), static pressure (not as much needed). But<br>the CFM (volumetric rate) is NOT changed by altitude, and neither is RPM of the<br>fan.<br>SCBA &amp; airline respirator rules Correct Answer: Must be Grade D or higher; can<br>use high pressure air; oil pumped with filtering is acceptable. Medical oxygen is<br>NOT allowed &#8211; dangerous because of increased flammability.<br>Abduction, adduction, flexion, extension Correct Answer: Adbuction: increasing<br>angle of arm to body, AWAY.<br>Adduction: decreasing angle of arm to body, TOWARD.<br>Extension: increasing angle of forearm to bicep.<br>Flexion: decreasing angle of forearm to bicep.<br>Grade D breathing air Correct Answer: 19.5%-23.5% oxygen<br>&lt;5 mg\/m3 of oil<br>&lt;10 ppm CO<\/p>\n\n\n\n<p>&lt;1000 ppm CO2.<br>TLV, PEL, IDLH for carbon monoxide Correct Answer: TLV of 50 ppm (ACGIH);<br>STEL of 400.<br>IDLH of 1500 ppm (NIOSH)<br>PEL of 35-50 (OSHA); ceiling is 200, instantaneous is 1500.<br>Carbon Monoxide (CO) Correct Answer: Air pollution that is a product of<br>combustion of fossil fuels. Flammable, colorless, odorless, poisonous. Chemical<br>asphyxiate. Does NOT harm red blood cells, but reduces their oxygen-carrying<br>capacity.<br>Teratogen Correct Answer: an agent or factor that causes malformation of an<br>embryo or fetus. Does not propagate across generational lines.<br>Next best option to electric forklifts for emissions. Correct Answer: Convert the<br>forklift to LP gas.<br>Double insulation does not protect against shock in what circumstance? Correct<br>Answer: Water, wet locations<br>(Data terms) Random, stratified, systematic, cluster Correct Answer: Random:<br>everyone has an equal change. Stratified: separated by layers. Systematic:<br>patterned response. Cluster: confined to a location.<br>pH less than 7 Correct Answer: acid<br>pH greater than 7 Correct Answer: base<br>activated carbon Correct Answer: A form of specially treated, porous carbon, used<br>to absorb various odors and vapors. Has a non-polar surface.<br>Axial flow fans Correct Answer: High volume and low pressure drop; general &amp;<br>dilution ventilation; NOT good for LEV; NOT used to move air through a duct;<br>sometimes used for comfort.<br>Centrifugal fans Correct Answer: Fan axis is perpendicular to flow &#8212; spits air out<br>90 degrees. Low noise. Suited to high pressures. Low to moderate static pressures;<br>used in heating &amp; air conditioning; workhorse of industrial hygiene; sometimes<br>called squirrel cages; good for lint, wood chips &amp; dust.<\/p>\n\n\n\n<p>Forward blades in centrifugal fan Correct Answer: Blades are curved in the<br>direction of rotation. Used whenever a large air volume has to be moved in a tight<br>space. Requires more power, which can overload motors.<br>Backward blades in centrifugal fan Correct Answer: Blades are curved in the<br>opposite direction of rotation. More efficient than forward blades.<br>Paddle wheel or long-shaving wheel Correct Answer: Used with medium tip speed<br>for buffing exhaust, woodworking exhaust or when heavy dust must pass through<br>the fan.<br>Max travel distance of fire extinguisher in light hazard occupancies Correct<br>Answer: 75 ft. Includes places like churches, clubs, education centers, kennels,<br>museums, homes.<br>Inspection items for self-closing doors Correct Answer: 1) Lubrication on guides<br>&amp; bearings<br>2) Binders are not bent, thus obstructing door<br>3) Chains\/wire ropes have not stretched.<br>4) Fusible links are NOT painted.<br>Main cause of sprinkler system failure Correct Answer: 35% of the time: closed<br>water-supply valves.<br>Main cause of leaking sprinkler heads Correct Answer: Overheating from being<br>too close to heat-generating processes.<br>How often should sound level meters be calibrated? Correct Answer: Before &amp;<br>after each survey<br>Particle sizes Correct Answer: Large: silica<br>Small: zinc<br>Safest method to determine electrical current Correct Answer: Split-core ammeter<br>Treating exposure to liquid oxygen Correct Answer: Warm water. Never rub or use<br>dry heat. Frozen tissue is painless but will be swollen &amp; painful when thawed.<\/p>\n\n\n\n<p>ASP Exam Preparation| 192 Questions<br>with 100% Correct Answers<br>Workers Comp &#8211; low fence Correct Answer: minimum dB loss before a worker is<br>eligible for compensation, because small hearing losses aren&#8217;t debilitating<br>Workers Comp &#8211; high fence Correct Answer: 100% hearing loss<br>Time-Loss Analysis Correct Answer: Technique that is based on the premise of a<br>natural course line for accidents &#8211;that is, with no outside intervention, each<br>accident sequence would eventually end.<br>Attractive Nuisance Doctrine Correct Answer: A person is under the duty to<br>prevent injury to children that may be attracted to something which could cause<br>harm<br>Business interruption recovery\/business continuity Correct Answer: Allows<br>facility to continue serving its customers even though the facility was nearly<br>destroyed by a fire<br>Contributory negligence Correct Answer: When an injured person&#8217;s care for his<br>own safety was less than that reasonable for a prudent person under existing<br>conditions<br>Fright without physical contact Correct Answer: Neurological or emotional<br>disturbances that occurred without physical injury<br>Foreseeability applied to rescue Correct Answer: allows damages to rescuer if<br>someone could have foreseen that their actions were going to cause an incident<br>where aid would be needed<br>Obvious peril Correct Answer: A manufacturer is not required to warn prospective<br>users of products whose use involves an obvious peril, especially those that are<br>well known to the general public<br>Strict liability Correct Answer: Manufacturer of a product is liable for injuries due<br>to defects, no proof needed of negligence or fault<br>ASP EXAM 192 + QUESTIONS &amp;<br>ANSWERS 2023 A+ GRADED 100%<br>VERIFIED<\/p>\n\n\n\n<p>Dangerous Instrumentality Correct Answer: A person who keeps, maintains,<br>transports, or stores a dangerous creature, device or substance is liable for injury or<br>damage, regardless of fault, even when he exercises due care<br>Great care Correct Answer: High degree of care that a very prudent and cautious<br>person would undertake for the safety of others &#8212; (bus, trains, airplanes).<br>Res ipsa loguitur Correct Answer: occurrence of an accident is sufficient proof<br>that negligence existed<br>Sneak circuit analysis Correct Answer: A technique which is used to determine an<br>unintended energy route, which can allow an undesired function to occur, prevent<br>desired functions from occurring, or adversely affect the timing of functions<br>HAZOP Analysis Correct Answer: Multi-disciplinary team to brainstorm and<br>identify the consequences of deviations from design intent. Uses guide words<br>Failure modes effects analysis &#8211; FMEA Correct Answer: Classic inductive<br>reasoning process. Failure or malfunction of each component is considered and the<br>effects of the failure traced throughout the system<br>Fault tree analysis Correct Answer: Classic deductive reasoning process. Selects<br>the undesired outcome and all possible modes of happenings<br>Cut Set Correct Answer: Shortest path to failure in a fault tree<br>Velocity of discharge from a fire extinguisher Correct Answer: Q = 12.1 * square<br>root of P, Q = velocity of discharge, P = pressure in PSI<br>ASME and API Standard 620 Correct Answer: Code(s) utilized in the design and<br>construction of pressure vessels<br>Flow rate (in gpm) of water from fire hydrant Correct Answer: Q= k * square root<br>of P; &#8220;k factor&#8221; will be specific to the type of hydrandt<br>Pre-action sprinkler system Correct Answer: Water supply is activated by a a fire<br>alarm system. Protects against damage if to building if sprinkler pipes\/heads leak<\/p>\n","protected":false},"excerpt":{"rendered":"<p>ASP Associate Safety Professional ExamA 40 ton gantry crane has been out of service for more than 6 months forstructural repair. It is required to be proof tested at ?? Before being used? &#8211; ANS 50 tons A body that has a definite volume but no definite shape is? &#8211; ANS A liquid A cage [&hellip;]<\/p>\n","protected":false},"author":1,"featured_media":0,"comment_status":"open","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"site-sidebar-layout":"default","site-content-layout":"","ast-site-content-layout":"default","site-content-style":"default","site-sidebar-style":"default","ast-global-header-display":"","ast-banner-title-visibility":"","ast-main-header-display":"","ast-hfb-above-header-display":"","ast-hfb-below-header-display":"","ast-hfb-mobile-header-display":"","site-post-title":"","ast-breadcrumbs-content":"","ast-featured-img":"","footer-sml-layout":"","ast-disable-related-posts":"","theme-transparent-header-meta":"","adv-header-id-meta":"","stick-header-meta":"","header-above-stick-meta":"","header-main-stick-meta":"","header-below-stick-meta":"","astra-migrate-meta-layouts":"default","ast-page-background-enabled":"default","ast-page-background-meta":{"desktop":{"background-color":"","background-image":"","background-repeat":"repeat","background-position":"center center","background-size":"auto","background-attachment":"scroll","background-type":"","background-media":"","overlay-type":"","overlay-color":"","overlay-opacity":"","overlay-gradient":""},"tablet":{"background-color":"","background-image":"","background-repeat":"repeat","background-position":"center center","background-size":"auto","background-attachment":"scroll","background-type":"","background-media":"","overlay-type":"","overlay-color":"","overlay-opacity":"","overlay-gradient":""},"mobile":{"background-color":"","background-image":"","background-repeat":"repeat","background-position":"center center","background-size":"auto","background-attachment":"scroll","background-type":"","background-media":"","overlay-type":"","overlay-color":"","overlay-opacity":"","overlay-gradient":""}},"ast-content-background-meta":{"desktop":{"background-color":"var(--ast-global-color-5)","background-image":"","background-repeat":"repeat","background-position":"center center","background-size":"auto","background-attachment":"scroll","background-type":"","background-media":"","overlay-type":"","overlay-color":"","overlay-opacity":"","overlay-gradient":""},"tablet":{"background-color":"var(--ast-global-color-5)","background-image":"","background-repeat":"repeat","background-position":"center center","background-size":"auto","background-attachment":"scroll","background-type":"","background-media":"","overlay-type":"","overlay-color":"","overlay-opacity":"","overlay-gradient":""},"mobile":{"background-color":"var(--ast-global-color-5)","background-image":"","background-repeat":"repeat","background-position":"center center","background-size":"auto","background-attachment":"scroll","background-type":"","background-media":"","overlay-type":"","overlay-color":"","overlay-opacity":"","overlay-gradient":""}},"footnotes":""},"categories":[25],"tags":[],"class_list":["post-117654","post","type-post","status-publish","format-standard","hentry","category-exams-certification"],"_links":{"self":[{"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/posts\/117654","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/comments?post=117654"}],"version-history":[{"count":0,"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/posts\/117654\/revisions"}],"wp:attachment":[{"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/media?parent=117654"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/categories?post=117654"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.learnexams.com\/blog\/wp-json\/wp\/v2\/tags?post=117654"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}