What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17)
t(8; 14)
TIP: Burkkitt's 8 letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of
0.5, the probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5?.5 %
Multiply all PI together = CPI
(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation
Frame-shift mutation
Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site
Hairpin loops
Which of the following statements are characteristics of the melt curve analysis?
(hint: more than one answer)
a. At the melting point, the probe separates from the target strand and fluorescence
rapidly decreases.
b. The melting temperature of double stranded DNA depends on its base
composition and length.
c. All PCR products for a specific primer pair should have the same melting
temperature.
d. When hybridization probes are utilized, the temperature is incrementally
decreased while fluorescence is monitored.
At the melting point, the probe separates from the target strand and fluorescence
rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition
and length.
All PCR products for a specific primer pair should have the same melting
temperature.
In the field of molecular diagnostics, which one of the following genes is responsible
for the synthesis of DNA, promote cell division, and inhibit cell death?ÂÂ